Logo
International Journal of
Multidisciplinary
Research and Development

Search

ARCHIVES
VOL. 10, ISSUE 1 (2023)
Effect of differential production media on crude amylase produced by Novel Bacillus Subtilis sp. using submerged fermentation
Authors
Itoandon E E
Abstract
A preliminary investigation was carried out on the effect of different production media on amylase activity using submerged fermentation technique. A newly Bacillus subtilis sp. was constructed using in vivo modulation technique involving cloning of amylase gene insert with a designed 5’–3’ forward primer (AAGGAGACGCGTATGTTTGCAAAACGATTCAAAACC) and 3’ – 5’ reverse primer (ATGTGATCTAGAATGGGGAAGAGAACCGCTTAAG) carrying an efficient targeted aprE subtilisin signal peptide bond. Luria Bertani (%), Peptone broth (%) and Pikovskaya broth (%) were used for amylase production by submerged fermentation technique. The results obtained showed that at optimal temperature 60oC and pH 6.0 respectively; Pikovskaya broth gave the best amylase activity of 4.3 (U/ml) compared to amylase extract from Luria Bertani and Peptone broth respectively. Bacillus subtilis RIK 1285 was used as control to estimate the functionality of the newly constructed strain. The experiment showed how different factors such as nitrogen and carbon sources as well as trace elements can affect a microbial expression within a reaction.
Download
Pages:1-5
How to cite this article:
Itoandon E E "Effect of differential production media on crude amylase produced by Novel <em>Bacillus Subtilis</em> sp. using submerged fermentation". International Journal of Multidisciplinary Research and Development, Vol 10, Issue 1, 2023, Pages 1-5

Please enter the email address corresponding to this article submission.

Effect of differential production media on crude amylase produced by Novel Bacillus Subtilis sp. using submerged fermentation | International Journal of Multidisciplinary Research and Development